header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180213-182
CRISPR Name: CRISPR1-chrna6
Target: chrna6 (1)
Source:
Target Sequence:
5' - GGATGAAGTCAATCAGATCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-chrna6 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-chrna6
Genomic Feature Affected Genomic Regions    
zko426a chrna6    
zko426b chrna6    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-chrna6 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-chrna6
No data available

Phenotype of all Fish created by or utilizing CRISPR1-chrna6
No data available
Genome Resources:
CITATIONS (1)