ZFIN ID: ZDB-CRISPR-180213-142
CRISPR Name: CRISPR1-phox2ba
Target: phox2ba (1)
Source:
Target Sequence:
5' - GGCTTATGAACGAGGCGTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-phox2ba No data available
GENOMIC FEATURES CREATED WITH CRISPR1-phox2ba
Genomic Feature Affected Genomic Regions    
zko361a phox2ba    
zko361b phox2ba    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-phox2ba No data available
PHENOTYPE
Phenotype resulting from CRISPR1-phox2ba
No data available

Phenotype of all Fish created by or utilizing CRISPR1-phox2ba
No data available
Genome Resources:
CITATIONS (1)