header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180123-3
CRISPR Name: CRISPR3-csf3r
Target: csf3r (1)
Source:
Target Sequence:
5' - CCTCGCCTTCAAGACACAAGCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-csf3r No data available
GENOMIC FEATURES CREATED WITH CRISPR3-csf3r
Genomic Feature Affected Genomic Regions    
gl31 csf3r    
gl32 csf3r    
gl33 csf3r    
gl34 csf3r    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-csf3r No data available
PHENOTYPE
Phenotype resulting from CRISPR3-csf3r
Phenotype of all Fish created by or utilizing CRISPR3-csf3r
OTHER CRISPR3-csf3r CRISPR PAGES No links to external sites
CITATIONS (3)