ZFIN ID: ZDB-CRISPR-171121-1
CRISPR Name: CRISPR1-mettl3
Target: mettl3 (1)
Source:
Target Sequence:
5' - CAGTCTCATTGGCTACTGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-mettl3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-mettl3
Genomic Feature Affected Genomic Regions    
ioz12 mettl3    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-mettl3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-mettl3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-mettl3
Phenotype Fish Conditions Figures
whole organism dead, abnormal mettl3ioz12/ioz12 standard conditions text only from Zhang et al., 2017
OTHER CRISPR1-mettl3 CRISPR PAGESNo links to external sites
CITATIONS (1)