ZFIN ID: ZDB-CRISPR-171113-1
CRISPR Name: CRISPR1-slit3
Target: slit3 (1)
Source:
Target Sequence:
5' - GAAGCCGGTTCCGGTTCAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-slit3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-slit3
Genomic Feature Affected Genomic Regions    
wz07 slit3    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-slit3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-slit3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-slit3
No data available
Genome Resources:
CITATIONS (1)