header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-171018-1
CRISPR Name: CRISPR1-klf6a
Target: klf6a (1)
Source:
Target Sequence:
5' - GCTTGAAGAATACTGGCAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-klf6a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-klf6a
Genomic Feature Affected Genomic Regions    
ioz102 klf6a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-klf6a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-klf6a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-klf6a
Phenotype Fish Conditions Figures
hematopoietic stem cell myb expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
hematopoietic stem cell myb expression decreased distribution, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
whole organism posterior region hbae1.1 expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
whole organism posterior region spi1b expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
hematopoietic stem cell gata1a expression decreased distribution, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
intermediate cell mass of mesoderm posterior region ccl25b expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 5 with image from Xue et al., 2017
hematopoietic stem cell lyz expression decreased distribution, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
hematopoietic stem cell gata1a expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
hematopoietic stem cell lyz expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
caudal hematopoietic tissue hematopoietic stem cell proliferation decreased occurrence, abnormal klf6aioz102/ioz102 standard conditions Fig. 3 with image from Xue et al., 2017
whole organism posterior region ccl25b expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 5 with image from Xue et al., 2017
whole organism klf6a expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
whole organism posterior region myb expression decreased amount, abnormal klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
hematopoietic stem cell migration decreased occurrence, abnormal ioz1Tg ; s896Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
caudal vein plexus hematopoietic stem cell decreased amount, abnormal ioz1Tg ; s896Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
brain vasculature hemorrhagic, abnormal s843Tg ; sd2Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
caudal vein plexus decreased volume, abnormal s843Tg ; sd2Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
caudal vein plexus decreased thickness, abnormal s843Tg ; sd2Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
caudal vein plexus disorganized, abnormal s843Tg ; sd2Tg ; klf6aioz102/ioz102 standard conditions Fig. 2 with image from Xue et al., 2017
Genome Resources:
CITATIONS (1)