header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-171010-4
CRISPR Name: CRISPR7-ccn2a
Target: ccn2a (1)
Previous Name: CRISPR7-ctgfa

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGACACCTGTGGGTGCTGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR7-ccn2a No data available
GENOMIC FEATURES CREATED WITH CRISPR7-ccn2aNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR7-ccn2a No data available
PHENOTYPE
Phenotype resulting from CRISPR7-ccn2a
No data available

Phenotype of all Fish created by or utilizing CRISPR7-ccn2a
No data available
OTHER CRISPR7-ccn2a CRISPR PAGESNo links to external sites
CITATIONS (1)