header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170829-13
CRISPR Name: CRISPR17-tyr
Target: tyr (1)
Previous Name: rank 14 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGTAGTGTGTGCGGGGCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR17-tyr No data available
GENOMIC FEATURES CREATED WITH CRISPR17-tyr No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR17-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR17-tyr
No data available

Phenotype of all Fish created by or utilizing CRISPR17-tyr
No data available
OTHER CRISPR17-tyr CRISPR PAGES No links to external sites
CITATIONS (1)