CRISPR

CRISPR3-chd7

ID
ZDB-CRISPR-170801-1
Name
CRISPR3-chd7
Previous Names
None
Target
Sequence
5' - GGGGACTGTGGCTACCCTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hsi3 chd7
Expression
Gene expression in Wild Types + CRISPR3-chd7
No data available
Phenotype
Phenotype resulting from CRISPR3-chd7
No data available
Phenotype of all Fish created by or utilizing CRISPR3-chd7
Phenotype Fish Conditions Figures
melanocyte spatial pattern, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
heart increased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
intestinal motility disrupted, abnormal chd7hsi3/hsi3 standard conditions Fig. 7 from Cloney et al., 2018
cranial nerve X neuron projection decreased amount, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 from Cloney et al., 2018
swim bladder uninflated, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
heart increased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 with image from Prykhozhij et al., 2017
eye decreased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 with image from Prykhozhij et al., 2017
swim bladder uninflated, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 with image from Prykhozhij et al., 2017
enteric neuron neuron projection decreased amount, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 from Cloney et al., 2018
heart edematous, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 with image from Prykhozhij et al., 2017
cranial nerve X neuron projection decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Cloney et al., 2018
enteric neuron neuron projection decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Cloney et al., 2018
intestinal motility disrupted, abnormal chd7hsi3/+ standard conditions Fig. 7 from Cloney et al., 2018
heart increased size, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
swim bladder uninflated, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
melanocyte spatial pattern, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
Citations