ZFIN ID: ZDB-CRISPR-170417-1
CRISPR Name: CRISPR1-nf1a
Target: nf1a (1)
Source:
Target Sequence:
5' - GGTCAGGCCATTGATGACGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nf1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nf1aNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nf1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nf1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nf1a
No data available
OTHER CRISPR1-nf1a CRISPR PAGESNo links to external sites
CITATIONS (1)