ZFIN ID: ZDB-CRISPR-170316-1
CRISPR Name: CRISPR2-lclat1
Target: lclat1 (1)
Source:
Target Sequence:
5' - ACACACACTGACCAAAGCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR is specific for qWIK wild type line.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-lclat1 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-lclat1 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-lclat1 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-lclat1
No data available

Phenotype of all Fish created by or utilizing CRISPR2-lclat1
No data available
Genome Resources:
CITATIONS (1)