ZFIN ID: ZDB-CRISPR-170315-7
CRISPR Name: CRISPR1-gata1a
Target: gata1a (1)
Source:
Target Sequence:
5' - GTCTGATAAGGGGTCTGTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR is specific for qWIK wild type line.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-gata1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-gata1a No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-gata1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-gata1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-gata1a
No data available
Genome Resources:
CITATIONS (1)