header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170113-2
CRISPR Name: CRISPR1-cyp19a1a
Target: cyp19a1a (1)
Previous Name: exon 1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGGCTCATAACGGCACTGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-cyp19a1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-cyp19a1a
Genomic Feature Affected Genomic Regions    
ihb158 cyp19a1a    
ihb159 cyp19a1a    
umo7 cyp19a1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-cyp19a1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-cyp19a1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-cyp19a1a
OTHER CRISPR1-cyp19a1a CRISPR PAGESNo links to external sites
CITATIONS (2)