CRISPR

CRISPR1-ar

ID

ZDB-CRISPR-161228-1

Name

CRISPR1-ar

Previous Names

None

Target

ar (1)

Sequence

5' - GGCCATTGAGCCCGAGGTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb1225	ar
ihb1226	ar

Expression

Gene expression in Wild Types + CRISPR1-ar

No data available

Phenotype

Phenotype resulting from CRISPR1-ar

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ar

Phenotype	Fish	Conditions	Figures
oocyte degenerate, abnormal	ar^{ihb1225/ihb1225}	standard conditions	Fig. 2 from Yu et al., 2020
female organism increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
ovary transparent, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
ovary has fewer parts of type oocyte, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
female organism increased weight, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
male organism pectoral fin breeding tubercle absent, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 3 from Yu et al., 2018
ovary cyp11a1.1 expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
ovarian follicle atretic, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
ovary foxl2a expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
testis cyp19a1a expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
ovary lacks all parts of type oocyte, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
testis hsd17b1 expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
testis has fewer parts of type spermatocyte, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 , Fig. S5 from Yu et al., 2018
sperm decreased cellular motility, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
male organism decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
testis transparent, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
oocyte stage IV decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 , Fig. S4 from Yu et al., 2018
female organism has fewer parts of type oocyte, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. S4 from Yu et al., 2018
ovary lhcgr expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
spermatogenic cyst decreased size, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
spermatogenesis arrested, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
testis cyp17a1 expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
ovary decreased size, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
male organism anal fin decreased pigmentation, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 3 from Yu et al., 2018
testis ccnd2a expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 from Yu et al., 2018
testis has fewer parts of type sperm, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 , Fig. S5 from Yu et al., 2018
testis star expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
germ cell proliferation decreased occurrence, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 from Yu et al., 2018
ovary cyp19a1a expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
testis germ line cell apoptotic, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 from Yu et al., 2018
visceral fat increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. S3 from Yu et al., 2018
testis has extra parts of type Sertoli cell, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
testis sox9a expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
ovarian follicle development arrested, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
ovary kitlga expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	control	Fig. 6 from Yu et al., 2018
female organism female sterile, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
male organism increased weight, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
testis degenerate, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. S5 from Yu et al., 2018
testis ar expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 1 from Yu et al., 2018
spermatogenesis delayed, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 , Fig. S5 from Yu et al., 2018
testis has extra parts of type spermatocyte, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 from Yu et al., 2018
male organism ratio female organism, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
ovary ar expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 1 from Yu et al., 2018
ovarian follicle degenerate, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
testis amh expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
fertilization decreased rate, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 from Yu et al., 2018
ovary hsd17b1 expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
testis has extra parts of type spermatogonium, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 , Fig. 5 , Fig. S5 from Yu et al., 2018
testis decreased size, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
ovary cyp17a1 expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 7 from Yu et al., 2018
spermatogonium increased size, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
male organism male sterile, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 4 from Yu et al., 2018
oocyte stage III decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 6 , Fig. S4 from Yu et al., 2018
ovary kitlga expression decreased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	chemical treatment by injection: 17beta-hydroxy-5alpha-androstan-3-one	Fig. 6 from Yu et al., 2018
testis gsdf expression increased amount, abnormal	ar^{ihb1225/ihb1225} (AB)	standard conditions	Fig. 5 from Yu et al., 2018
oocyte stage III decreased amount, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
ovarian follicle atretic, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
oocyte stage IV decreased amount, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
ovary lacks all parts of type oocyte, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
ovary transparent, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
female organism increased amount, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
female organism increased weight, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
male organism decreased amount, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
male organism anal fin decreased pigmentation, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 3 from Yu et al., 2018
ovary has fewer parts of type oocyte, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
ovary decreased size, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
male organism increased weight, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
ovarian follicle development arrested, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
female organism female sterile, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
fertilization decreased rate, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
male organism ratio female organism, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 2 from Yu et al., 2018
ovarian follicle degenerate, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. S6 from Yu et al., 2018
male organism pectoral fin breeding tubercle absent, abnormal	ar^{ihb1226/ihb1226} (AB)	standard conditions	Fig. 3 from Yu et al., 2018
ovary amh expression amount, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020
primordial germ cell normal amount, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 2 from Yu et al., 2020
ovary dmrt1 expression amount, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020
ovary kitlga expression amount, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	chemical treatment by environment: flutamide	Fig. 4 from Yu et al., 2020
ovary kitlga expression amount, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020
pectoral fin breeding tubercle female organism absent, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	chemical treatment by environment: flutamide	Fig. 3 from Yu et al., 2020
pectoral fin breeding tubercle female organism present, ameliorated	ar^ihb1225/+; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 3 from Yu et al., 2020
ovary amh expression amount, ameliorated	ar^{ihb1225/ihb1225}; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020
ovary dmrt1 expression amount, ameliorated	ar^{ihb1225/ihb1225}; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020
oocyte degenerate, exacerbated	ar^{ihb1225/ihb1225}; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 2 from Yu et al., 2020
ovary kitlga expression amount, ameliorated	ar^{ihb1225/ihb1225}; nedd8^{ihb1227/ihb1227}	chemical treatment by environment: flutamide	Fig. 4 from Yu et al., 2020
ovary kitlga expression amount, ameliorated	ar^{ihb1225/ihb1225}; nedd8^{ihb1227/ihb1227}	standard conditions	Fig. 4 from Yu et al., 2020

Citations