ZFIN ID: ZDB-CRISPR-160527-19
CRISPR Name: CRISPR4-brd1a
Target: brd1a (1)
Source:
Target Sequence:
5' - GGATGAGGATCCTTTGGCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-brd1a No data available
GENOMIC FEATURES CREATED WITH CRISPR4-brd1aNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-brd1a No data available
PHENOTYPE
Phenotype resulting from CRISPR4-brd1a
No data available

Phenotype of all Fish created by or utilizing CRISPR4-brd1a
No data available
OTHER CRISPR4-brd1a CRISPR PAGESNo links to external sites
CITATIONS (1)