header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-160525-5
CRISPR Name: CRISPR2-kat8
Target: kat8 (1)
Source:
Target Sequence:
5' - GATCGAGAACGAGAAGCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-kat8 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-kat8 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-kat8 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-kat8
No data available

Phenotype of all Fish created by or utilizing CRISPR2-kat8
No data available
Genome Resources:
CITATIONS (1)