header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-160128-25
CRISPR Name: CRISPR4-hgfa
Target: hgfa (2)
Previous Name: Z000035 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGGGTCAAGGAGAGGGCTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-hgfa No data available
GENOMIC FEATURES CREATED WITH CRISPR4-hgfaNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-hgfa No data available
PHENOTYPE
Phenotype resulting from CRISPR4-hgfa
No data available

Phenotype of all Fish created by or utilizing CRISPR4-hgfa
No data available
OTHER CRISPR4-hgfa CRISPR PAGES
  • CRISPRz:Z000035 (1)
  • CITATIONS (2)