ZFIN ID: ZDB-CRISPR-160128-237
CRISPR Name: CRISPR2-notch2
Target: notch2 (1)
Previous Name: Z000318 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGACGAACTCCAGCTCTGTACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 8 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-notch2 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-notch2No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-notch2 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-notch2
No data available

Phenotype of all Fish created by or utilizing CRISPR2-notch2
No data available
OTHER CRISPR2-notch2 CRISPR PAGES
  • CRISPRz:Z000318 (1)
  • CITATIONS (1)