ZFIN ID: ZDB-CRISPR-151203-20
CRISPR Name: CRISPR2-esco2
Target: esco2 (1)
Source:
Target Sequence:
5' - TTTCTGACCCGACGCCACAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-esco2 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-esco2 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-esco2 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-esco2
No data available

Phenotype of all Fish created by or utilizing CRISPR2-esco2
No data available
Genome Resources:
CITATIONS (1)