header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-150925-4
CRISPR Name: CRISPR1-mecp2
Target: mecp2 (1)
Source:
Target Sequence:
5' - TCCGTTCCAAGGTGGAGCTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-mecp2 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-mecp2No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-mecp2
Expressed Gene Anatomy Figures
gfap Fig. 7 with image from Gao et al., 2015
map2 Fig. 7 with image from Gao et al., 2015
nes Fig. 7 with image from Gao et al., 2015
neurod1 Fig. 7 with image from Gao et al., 2015
PHENOTYPE
Phenotype resulting from CRISPR1-mecp2
Phenotype of all Fish created by or utilizing CRISPR1-mecp2
OTHER CRISPR1-mecp2 CRISPR PAGESNo links to external sites
CITATIONS (1)