ZFIN ID: ZDB-CRISPR-150813-1
CRISPR Name: CRISPR5-en1b
Target: en1b (1)
Previous Name: CRISPR5-eng1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGATGTTTCTGGATGGGCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR5-en1b No data available
GENOMIC FEATURES CREATED WITH CRISPR5-en1b
Genomic Feature Affected Genomic Regions    
nns40Tg en1b    
nns42Tg    
nns55Tg en1b    
nns58Tg en1b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR5-en1b No data available
PHENOTYPE
Phenotype resulting from CRISPR5-en1b
No data available

Phenotype of all Fish created by or utilizing CRISPR5-en1b
No data available
Genome Resources:
CITATIONS (5)