ZFIN ID: ZDB-CRISPR-150731-27
CRISPR Name: CRISPR2-cntnap2b
Target: cntnap2b (2)
Previous Name: Z000476 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GAATGAAGTCGGGGTTGCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-cntnap2b No data available
GENOMIC FEATURES CREATED WITH CRISPR2-cntnap2b No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-cntnap2b No data available
PHENOTYPE
Phenotype resulting from CRISPR2-cntnap2b
No data available

Phenotype of all Fish created by or utilizing CRISPR2-cntnap2b
No data available
Genome Resources: CRISPRz:Z000476 (1)
CITATIONS (2)