CRISPR

CRISPR2-cntnap2b

ID
ZDB-CRISPR-150731-27
Name
CRISPR2-cntnap2b
Previous Names
  • Z000476 (1)
Target
Sequence
5' - GAATGAAGTCGGGGTTGCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-cntnap2b
No data available
Phenotype
Phenotype resulting from CRISPR2-cntnap2b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cntnap2b
No data available
Citations