ZFIN ID: ZDB-CRISPR-150519-1
CRISPR Name: CRISPR1-urod
Target: urod (1)
Source:
Target Sequence:
5' - AGTTCAGGGAATCACGGGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-urod
GENOMIC FEATURES CREATED WITH CRISPR1-urod No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-urod No data available
PHENOTYPE
Phenotype resulting from CRISPR1-urod
Phenotype of all Fish created by or utilizing CRISPR1-urod
Genome Resources:
CITATIONS (1)