ZFIN ID: ZDB-CRISPR-150323-7
CRISPR Name: CRISPR4-en1b
Target: en1b (1)
Previous Name: CRISPR4-eng1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGCTATTTGCGATGTTATTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This construct contains a mismatch at the 5' end. The first nucleotide was changed from A to G.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-en1b No data available
GENOMIC FEATURES CREATED WITH CRISPR4-en1bNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-en1b No data available
PHENOTYPE
Phenotype resulting from CRISPR4-en1b
No data available

Phenotype of all Fish created by or utilizing CRISPR4-en1b
No data available
OTHER CRISPR4-en1b CRISPR PAGESNo links to external sites
CITATIONS (1)