CRISPR

CRISPR2-drd3

ID
ZDB-CRISPR-140710-5
Name
CRISPR2-drd3
Previous Names
  • drd3_GGN18 (1)
Target
Sequence
5' - GGGGGCTGTAGTTTCCCCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 10 target locations
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-drd3
No data available
Phenotype
Phenotype resulting from CRISPR2-drd3
No data available
Phenotype of all Fish created by or utilizing CRISPR2-drd3
No data available
Citations