ZFIN ID: ZDB-CRISPR-131205-4
CRISPR Name: CRISPR1-rgs4
Target: rgs4 (2)
Previous Name: Z000425 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGAGAAGGTGAAGGACACTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-rgs4 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-rgs4No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-rgs4 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-rgs4
Phenotype Figures
whole organism morphology, abnormal Fig. S4 from Hwang et al., 2013

Phenotype of all Fish created by or utilizing CRISPR1-rgs4
Phenotype Fish Conditions Figures
whole organism morphology, abnormal WT + CRISPR1-rgs4 standard conditions Fig. S4 from Hwang et al., 2013
OTHER CRISPR1-rgs4 CRISPR PAGES
  • CRISPRz:Z000425 (1)
  • CITATIONS (3)