ZFIN ID: ZDB-CRISPR-131118-1
CRISPR Name: CRISPR1-tyr
Target: tyr (2)
Previous Names: TyrsgRNA1 (1), Z000261 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGACTGGAGGACTTCTGGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-tyr
GENOMIC FEATURES CREATED WITH CRISPR1-tyr
Genomic Feature Affected Genomic Regions    
ck112a tyr    
zf451 tyr    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR1-tyr
Phenotype Figures
whole organism decreased pigmentation, abnormal Fig. 2 from Carrington et al., 2015
whole organism degree of pigmentation, abnormal Fig. 3 with image from Wilk et al., 2017

Phenotype of all Fish created by or utilizing CRISPR1-tyr
Phenotype Fish Conditions Figures
whole organism melanocyte absent, abnormal tyrck112a/ck112a standard conditions Fig. 5 with image from Park et al., 2016
visual behavior process quality, abnormal tyrck112a/ck112a standard conditions Fig. 6 from Park et al., 2016
eye decreased size, abnormal tyrck112a/ck112a standard conditions Fig. 5 with image from Park et al., 2016
whole organism colorless, abnormal tyrck112a/ck112a standard conditions Fig. 5 with image from Park et al., 2016
retinal pigmented epithelium unpigmented, abnormal tyrck112a/ck112a standard conditions Fig. 5 with image from Park et al., 2016
melanin biosynthetic process from tyrosine disrupted, abnormal tyrzf451/zf451 standard conditions Fig. 3 with image from Jao et al., 2013
whole organism decreased pigmentation, abnormal WT + CRISPR1-tyr standard conditions Fig. 2 from Carrington et al., 2015
whole organism degree of pigmentation, abnormal WT + CRISPR1-tyr standard conditions Fig. 3 with image from Wilk et al., 2017
OTHER CRISPR1-tyr CRISPR PAGES
  • CRISPRz:Z000261 (1)
  • CITATIONS (19)