Genomic Feature

a1

ID
ZDB-ALT-980203-769
Name
a1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Dowling Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 6: 42374647 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
The mutation in a splice acceptor site results in a two-amino-acid deletion  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T in Acceptor Splice Site (1)
Transcript Consequence
Missense, Splice Site (1)
Protein Consequence
Amino Acid Deletion: 2 AA missing from position 138 to 139 (1)
Sequences
Flanking Sequence
ATTTTTTAATCAAACCTGATAGTGTAAAGGGAAGTGCAACTCTCACTTTAAGACAAAATTTAAAGGCAATAGCTATGGCAACAGTCCAATTTTAAATAAATAAACAAGCATATGTTTAAAGTTTTCAAATAATAAACAAAGTCATATTTGTTTAAGATTCTAAATAAATCAGCAAATCTTTATATAATACTACAACAAGCCATCACTGCTGGGGTTAAGTCTGTCAAATATGTTGTTCTATTGCATATAATTACCATTATCCTGTCCAAGAATCAGGGAATACATACTCCTGAGACCAAAGACATTCAGGAAATACCAAGATGCTGAGCTCACCCTGCAGATTAATACACCAGGAGATTATTTAAAGACAGCTTTAGGTAAAAAGGAAAGTGACACTCAAGGGTGAAAGAGCACTAACCAGGAGGCATCTAGAGAGAGCAACTCAATTCCCTGCTGCAGCATTGGCTTGAAGCGGAGTGTGAGAGGGAACGGTACTTTTG
C/A TTGGAGGAGAAAGCAAGAATTACAAATGCGTTAAGACACGTCTTGTAAGAATACACCTCAACAAGCCATATTTTATTCTGAATATTGTATGTCTTACTTGTAACAAACCCAGAGAAGGTCCAGTTGATCCAACCACCAATAAGAATCATAGGCAGGACATTTGTCACGTTGCCTTTCATCATATCGGTCAACATGCTCGGATCTAAAAGAGTGAAAAACATTCAATTAATCTCGTCACTCCTTTCTTGCTCAGTTTCTCTTCATAAAAGGCAAATCTTTGACCTCTTGTGTCTGTTTCAAGAAAAACTCACCAGTCATCGGAGACGGTGGGACCACCTTTCTCTTAGTCTTCTTAAAAAACCCATCTTCTTGGTTATTGAAGTAGAATTTTCTCATCAAGAAAGACTGTTTTAGCACAATACAACAAATCAGACGTTCTACTTTGATCACATCGCAAGCAAAATGCAAAAAAGATTGAAGAAGGCTCACTTGTTTAGGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations