Genomic Feature

a8

ID
ZDB-ALT-980203-416
Name
a8
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Dowling Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 19256681 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A at position 1170 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop at position 390 (1)
Sequences
Flanking Sequence
GTGCATTTCAATTGTTTTAATCTTAACTATGTTAAAGGAATGGTTGGACCAAACATGCCTCCTCCAGGACCCTCTGGTGTACCTCCAGGCCTGCAAGGACAACCCACCAATGGACCACCTAAACCTTGGCCTGAAGGTCAGTAAACTGTGTAAACGATCTCTAGTTGTTGCCAATAAGCAAGTGAAGTTAAACTTTACTGGGTGTTTTAGGCTACAGAGCCACATACTTACCTTGACTTTGTAATCCCAGGACCCATGGTGAACGCTGCTGCCCCCGCAAGTGCCCCACAGAAGCTGATACCCCCTCAGCCCACAGGCCGCCCTTCTCCAGCACCACCGTCAGTTCCTCCCGCTGCCTCCCCTGTCATGCCCCCTCAGACCCAGTCTCCAGGTCAGCCAGCCCAGCCACCGATGGTGCTGCACCAGAAACAGAACCGCATCACACCCATCCAGAAACCCCGGGGTCTAGACCCGGTGGAGATCCTCCAGGAAAGAGAGTA
C/A AGGTGAGATGAGTGTGACCTAATGCAGGGGTTCTCAAAGTGGGGGTCGGGACCCCTCGAGGGGTCGCGGGACAATGAAGGGGGGGGTCGCCAGGTGATTTAAAAAAATCTATTTATTATTATTAAATCGTATAAGAATGACCATATTTTATCCATAACCTACAGAAGAGAAAAAATATAGTCGTTTATAATTACTATATAGTTACTATAGTAGCTTATAGTTACTAGTTCTATTGGATTGCAACCCCAGTGGTAATTACATTATATTAAAGACACAGCAATAGCGTCAGATGCAGCAGATGGATTTTATAACACCAGGTTAAAGTTTCTGGCCCATTTACAGCACTGACATTAAACGAAGAATATACCTGGGTGTATCTGTGTGTGTGTGTGACATTGCATGCAAGGTTTCTGTATTCATAACCAGGATATTGGGGGTCGCGAGTCACTGGCATCGTCATATTGGGGGTCGCAGGCTGAAATGTTTGGGAAGCCCTGACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations