Genomic Feature

y657

ID
ZDB-ALT-220214-4
Name
y657
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with CRISPR
Lab of Origin
Harold Burgess Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 15: 19888967 - 19888983 (GRCz11) (1) Details
Nucleotide change
TTCGCACCAGCAGTACA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGCCATTTCTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAATGTAAAGAAAACCGTCTTATTTTGTGTAGTTATATTGCATGACTCACTGTGTTTTTTATTTTAGTTTTATTTGTTAATGCCTTGAATGTTCTGTCATTTCCCTTAATGGAACATGTGTCTTAATTCTTTCAAACAAAATTGCAGACATACATATACATTTTTACATTGCTACTGTACTGTTTTGCATTATTTCTACTGCTTCAAGCCCATACTTAAATATGGTTTAGCCCTCCTAAAGCAGAGAAAAAGGATTGTCTTAATAACCTGAAAGAGGTTTGCTGTTCAAAGGATCACAGGGGGAGAGGGGAATTTTGTTCTAACACACACTAATTTAGCTTAAATTTCCTCCAGGGGGAGAGACCTCAGCATGCAAACCCTCGTCTGTCCGGCTTGCACCCTCTCTTTCTTTCCATGCTGCTGGTCTTCAGATGGCTGCTCCCATGCCTCA
TTCGCACCAGCAGTACA/- GTGACTGTCACCAGCAGAGTACAGACCAGTCTGTCACTGTACTGCCGTACAGTGATCAGACACAAGCACTCACTGCCAGCCAGGTACTGAATGCCCTGCTTCTGTTTGTGCACCCTGAATAATTATAGATGAAGCATACCCAGTGTTTGCATTTTGTTAAATTAGATTTTGATTAATACCCTGGGCCAGACAGAATCTGCAGACATTTTTAATGCTGTTTCTGTGCAGAATTTTGTACAAAATCTATAAAATTGTGGAATGATTTTGAGAGTATACTAGTAATTATCTCTACACATGTTTTTTCAGCAAAATTATAGCAAATCTTTCAGATATGTACTAAAAGACAGAAAATATAACTTTACAGAACTGAATTGTACATTAATCATATACACTAGGGCTGCCCAATATATCATTTCAGCATCGATATTGCAATGTGAGCGTCATCAATAGTCCCATCACAAAGCTATGCAATGTTGAATCTGAATTATAGTCGGCCAGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations