Genomic Feature

ihb366

ID
ZDB-ALT-190910-4
Name
ihb366
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Cui Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 6: 7350569 - 7350573 (GRCz11) (1) Details
Nucleotide change
CATGC/-
Variant Notes
Between 888 bp to 892 bp of the wild-type abcc4 coding sequence, CATGC , is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted in Exon 7 (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TTTTTTTTTTAACTTTTTTTTTCTCTTAATTTTTTTTGTATAAGAAAATGTTGATTCAGGTTATGATCAAAAGTTCTTGAGTATGTTTTCACATTAATGTTACCTAATTTAAAGCAATTTTCCCCTTCCCAATACCATAATCACACTTATAATTAAAAATAAAATGTAAAATATTATTATACAATATAAATGGCTCAAAAAAAGAGTGCACTTTAAATATGCTAATGATACACTTATTTTTAGGGACGGAGCTTTCAAACTCTGATGAATAATTAAATGCCTTACAAAAATTATACATTAGACTGCTGAGGAAATCATGTGTAGTAGAGCATAATTTGGGACACACTAACATTATTTGTTCATACTGCAATGATTTCATCTCTCTCTCTGTCTCACAGGAGTAAAACCGCAGCCTTGACTGACAGCCGGATACGCACTATGAATGAGGTGGTTTCTGGCATACGTATAATTAAGATGTATGCCTGGGAGAAGCCGTTCGC
CATGC/- TGGTTAATGATGTACGAAGGTAAATTACATAGACTTATTGAGTCTGTTTGCACTGCTGTAGCTTGCGATAGGTCAGCAGATTGTGTTACTGACAAGACGGCATTTGTCCAAAGGTTTTATGGTTGTTACTTATTTCAAGGTTGAGACTTGAAGCACAGCATGAAAATGACTGTGTTTTAAAGAACTGTAAAACTTTGGGTCACTTAAGGGAGCGATAGAAAATGCTTGTGCTGGTAATTTCATCAGTAAATTTATTATCATTTATTACATTTTTAGGGGGAAGCAAGATCAGCCTGTCACTCAAATAAGATCCAGTATTAGCAAACCACAACCATCCAATTTATTCCCAATAGGCAAAATCAAGGCCTGCACTACATTTCTGTGCTTCATTTTAGGAGCCATTTCATTTGCTTGATTGTGAAAAATATTATATTATATTTAGGGTTCAAACGGTCCTGAAAACCTGGAAAAGTCATGGAATTTTGTAATTTTCCATGACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations