Genomic Feature

ihb357

ID
ZDB-ALT-190705-10
Name
ihb357
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with TALEN
Lab of Origin
Zhan Yin Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Delins
Variant Location
Chr 2: 37631854 - 37631866 (GRCz11) (1) Details
Nucleotide change
GTGTAGACAGACG/AAA
Variant Notes
Between 32bp to 34bp of the wild-type insra coding sequence, CGTCTGTCTACAC is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 13 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TGATTTCTTCGCAAAATAAATTAAAAAAAGACAGCACTAGAGGTCTTGACTGATCAGATTAGGGTTTAAAATCCTCTTGCAGCTCCTGTCAGGGCTACAAATGGCTGCATAAAACACGGGCCTGGCTGAACTTGAAAACCAGTTCGGGCTACAAATAGATCAATGTTGTACTCAAACGGTCGATAATCTGGCTTGGGGGCAATGCACACAGTCCGGATAACCTACCATGTCGTTAAAGACAGTTTCGAACGTTTAATCGCAATCAAAACGACCCAACATGGGATTTCTTCGTCCCTTTCACTGCAGTGCCCTCATGTCTGGCTCTGCTCTAGCAAATGTGTGACAGTGGTCAAAATCCACGATCCCCTTTTCGCGTTGCAGGGTGCTTTGTGGATTAACATTTCAACAGACAGACTCGTGTAGTATCATGTAGTATTAAAGACAAAACAGCGGTTAAGTTACACTTACTTTCTCCATTTGTTTGTTGACAGTTGCAAACA
GTGTAGACAGACG/AAA CAACCAAAACAATCAAAGTCCGCAGCCGCATTTTGACCCGCGGTAAAGCCGAAAATCGGTCCAAAAATCCCCTCCGAACTTGTCTTCTTGTGGGTAACGATCAGTTTTAATAGTCCGGTGTTGTTTTAGAAGGATAAAAATTAAAAAGAAAAGAACCCTGTCACCCACCCCTCTGAAAAAAATGGGCGGAGAGGAAAGTTCAACGTGTTCAATCCGCTCTGCTGTCGCGCGCACAGACTGATGCTGATATGAACACGCGCACGAGCGCTAAGCTAATGACAGCGCGTGGCCGCGACTTTCATTTACTGTATCCATACGAATAAAGCATAATTTAAAATGAGCAGCCGCATCATTTCGGATAGCTTGAATGTATTTGTCCAGCACTTGCGCAGTTTGTCCCAAGCCTGGCGAAAAAATGGGGTAAAAAAGCTGGCGATGTGGAATGGCTGCGCACACAGAGCGCAGGCCGAAGTAATCAATAGAGTTTACAAGAGACTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations