ZFIN ID: ZDB-ALT-190501-74
Genomic Feature: sa34758
Synonyms:
Affected Genomic Regions: slc4a3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 46604096 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
FLANKING SEQUENCE (GENOMIC)
ATTTGTTTGTTTTGGTAATATTCAATCAAAGTCTGACCGTTTTCTTCTGTGTTTGGATGGGCGATCCATCTATGATGATGTCAGTTTGAAGGCTTCAGCCACACTATTATTAACCACGCCTCTCTTGTCATTAGCTTGCAATTAGGTAATGTTGTACAAAAAGAAAGCTCCGCCCCCTACTCAATATTCAATACTCCATTTCAGTTGGAAGTACATTAACATCATGCTGATTTTAACCTGTCTTTGTTTTCTCAGATCACCGGCACACCTTCCACCATACCCACCACCCCCTGTCCACACATCTTCCACCGCAGCGTTTCCGAAAAAGGGTGCTCAGTATGGACCGCCGGCGGAAGAGAAAGAGGAAGAAAAAGAAGACGTCTATGCCTCCGTCAGATGTCACACCCACTATTCATGAAGTGGATGAGGAGGAGGCGGAGTCTGAAATCGAGGGGCAGTGTCAAGCAGCCACACCTACTGAGCCATCTGAAGAGCTGCCA
G/A
AGGTAACCTGAAAGAAAATATCATACTACTGTTTAGGGCAGAAAGTGCACACTGCCATTAAAGAAGTGCAAGTTACCTTTGCCAAGTGCACTGACACAACCCATTCCACGACAGACCCCGGCTTTTTGACTTGTTGGAGTCTGGATGATCCTTTTCTTCTTTGGTCTGGAGCATACAGCATCCATTTCTCCTCAAAAATACCTGAAATACTGATTCATCTGACTACAGTACAAGTTTCCACTGTGTGATGGTCCATTCCAGATGCCTCCTAGCAAAGTTAGGTTGACAGCGATTTTGGACACTGTTAACATATGGCTTCCTTTTGGCATAGTACAGTTTTATCTGGCATTTGTGGATGTAACAACATATTGTGGTACTTGACAAAGGTCTGCCAAAGTGGTCCTGAGCTCATGTGGTGATATTGCTTATAGATGATTCTATAGAGACAATTCTTAATGCAGCTTTTGAAAAAAACAGTGCCTATATGGTATAAATGAACA
(1)
OTHER sa34758 PAGES
ZMP:sa34758 (1)
GENOTYPES No data available

CITATIONS  (1)