header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190501-158
Genomic Feature: sa39824
Synonyms:
Affected Genomic Regions: col15a1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 23986040 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
FLANKING SEQUENCE
CCCGCCGACACAGCCAGAGCCAAGAGACCTTTGAAGAGGTGGAAGAGCGG
T/C
GAGTGCAGCTGCACTGAAAAAACAAACAGAGATTTATGGAGAGAACAAAA
(1)
OTHER sa39824 PAGES
ZMP:sa39824 (1)
GENOTYPES No data available

CITATIONS  (1)