ZFIN ID: ZDB-ALT-190403-8
Genomic Feature: y609
Synonyms:
Affected Genomic Regions: scn1lab (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR
Lab Of Origin: Harold Burgess Lab
Location: Chr 6: 10286465 - 10286466 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
Protein Consequence: Amino Acid Substitution: Ser>Stop at position 469 (1)
FLANKING SEQUENCE (GENOMIC)
CATATTTATGTCAAATTAAATTCCCACTTGGACATTTTTAATGCATTTGTAGCACTTTTAGGCCACATTTGAGCCCTTTAATCCCCATAAGTGCATTACTGAGCATTTAATGCGAAGATTAAACCCTTTTCTGTCTCCTGTCACACCTTTGCTCAGTGCCATAGTTGATTATCACTCCACCCACATAAACTATGTAACAGAATATAGCTAAGAAGCTAACAAAACACAGAAGAGTTGACTAAACTACATTTCCCACAATGCCACACAGCAGAGCAAGTCACCTGATTAGGAGTTGAGCATTTCTTTTCATATGAGAGTCGGTTGGCATCAATGGAAAAGCGAAAGCCGGGCCGTCTGATGCTGTCCTCTGAGGCAGACTTGTGGAATTTCTCCTGGTCGGCTTTCTCCTCTTCCTCTCTCTGTTTTCTCTTCTTCCTGCGGTTCCTCCTTTCTTTAGCACTCTTCGAACTCAGTCTAGACCCCCCAGAGGAGCTCTCCTC
CG/-
ACAGGCCCCCCCTTCCGCTGTACTCCCCGCTCTCTGTCGCTGCTGCCGCGGCAACCTGCCAACCAATCACAGCACAGGCACTGTCGTCAGGGGCAACCGTGGCTAGACTTAGTTCAAGCTTACATAGGGAAAGCAGAGGCAGGACATGGACAAACAGTGAGCGCCGAAGAACGACAGAAGATCACTTTATTTGTTTGGTCAGACTATCAGATTTTTGATTTTCTCACTAATCCATCTTTTCCTTATTAGGTCTCCCTTACTTGTAATATCCCATCTAATAACCCTAACTACCCCAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGAATGAGGGAGAGAGCGAGGGATAGATAGATAGATAGATAGATAGACAGA
OTHER y609 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous scn1laby609/+ (AB) scn1lab Unknown

CITATIONS  (2)