ZFIN ID: ZDB-ALT-190403-7
Genomic Feature: y608
Synonyms:
Affected Genomic Regions: chd8 (1)
Type: Small Deletion (1)
Protocol:
Lab Of Origin: Harold Burgess Lab
Location: Chr 2: 38114292 - 38114296 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted (1)
Transcript Consequence: Frameshift (1)
Protein Consequence: Amino Acid Substitution: 91 AA added at position 344 (1)
FLANKING SEQUENCE (GENOMIC)
AGGTTTTATTACACTTTATGTATTAGTCTCCAAGAGAGAAAACATTAGCATTATTTCAGATGTTAAAAACACCCGAGAAAGTTCACAGAACTATAAAAGAGATTTGAAAAAATGTTCTACCTGTGGCTGCAGCAGTAGTTTAAGGGGCACTGCTAGTCTTTGTCCTCCTTGGCCTTGAGAAATCTGCACCACCTGTGGACTGCCACCAGCATTTGCTGCCCCAGAAACCAACTGAAACTGTTGCAAGAAAAGCTTCAAGTCACCAGCGAGATACAAGTAAAAGCCAATCTTCCAACACCCAACCCTGTCCTTTCGCTCACCTTGGCTCCCTGTTGGTTGGGCTGCTGTTGAACCTGCAGCTGAATAGTGAGCACTTTTGCCTGTGCACCCGTTTGACCTGCCTTGGCTTGGGCGAGTGCTGCCAGCTGGTCTCCCTGCAGGACTAACTTCCCTGGCAGAGAGCCCAACACCAGCCTGGGCTGCTGGCCTTGCTGACCCGA
CCCTG/-
CAGTTCCCCCTACTGTCACCGTCCCAGCTTGGGCAGCTCCACCTTGTGAGGGCTGCTGTAGCACCAGAGTGATCCTCTTTGCTTCCCCCTGAAAAAGAAAGAGGGGCTTTTAGGTCTCTGACAGCGGGGGAAAAAACTAAATAGAGCAATGCGAACAGTGTTCATTTACCATTGAAACACTTTAACAGTTTATCAATATTTGACATTAGGTGTTATTCTTAAGTGTTCTGTTTATATATTCTGTTGTGCTTTTATTTTTTGTTAATATAAAATGTCTATGTAGCTTTTCATGCACCTTTATTTTTGCACTTTACTTTAGATTGAATACTTAGATTGAATAGTTAAAGCAAAAATGTAAGTGTCAGATATCAGATGTCAAATATCAGATTTTCCCTATAATTTATTAAAGTGGTTTTAAAAGTTGTTTACATCATTTATTAGAGTGGTTTATTCAGGTTTTAGTCTGTATGATGATAATTCAAGTTAAAATCTGACCTGCT
OTHER y608 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous chd8y608/+ (AB) chd8 Unknown

CITATIONS  (2)