ZFIN ID: ZDB-ALT-190403-3
Genomic Feature: y607
Synonyms:
Affected Genomic Regions: arid1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR
Lab Of Origin: Harold Burgess Lab
Location: Chr 20: 5039683 - 5039695 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 13 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Amino Acid Substitution: 16 AA added at position 391 (1)
FLANKING SEQUENCE (GENOMIC)
TGAGCACAATTTAGAGCACACACACTTCTCAAACAATCCGGGAAATGGGCCTGGGCATGGTTCGGATAGCATAGTGTGAGTAGGCTCTAAAAGCCTTGTCTATTTCACGAGGTGCATGCACAGTCAGCAGAGTTTAGCGACGTGGCGGAAAGTATAAATCAGCCTTTAATCTCTTAAAATCAATAAAGCGCTTTATTTCATTTGTATCTTTGCTCTAATGTGTTTATCTATGCAAGTAATTTGTTTATTATTACTAATGCAGATACACTCCCCTACAAAATCATCCCAATCATTGTAAAATTATGAATTGTTTCCAAAAAGAGCTCAAAATCAACTGGCGAATCTGTATTTTTAATTGCAATATATAATCTCAGAGCACCAAAACATTGCAAAACCTCAAAGTATCATGCAGCCCTACTGTACAGCTTTAAAAAGAGCTTTGTTTTCTGAGTAATCTTTAGTAACACTCATTGTTTCTACCTGTTGCTGAGAGTACTGCA
TTCCTCCGATGCC/-
AACTTGCCCACGGCCCTGCATTCCCATTGGATATCGGTGAGCAGTGGGTGATCCGTATGGCTGTCCGGCATAAGTTCCTTGCTGGGAATAGGGATTGTTGCCCATCCCATACATCTGAGAACGCTTCATGGTCATAGGGTCCATAGTTGCCACCTGTTGAGAGTGATGTCAACACTTTAGCATGAGGAACATCGACGGTGATTTCCAATGTAAGGCAGTCTGTGTGAACACATTTATGTGACTATTATGGCTGAGCAGACTGGAATACAAATAGTAATCATAAGGTTGAGCGCCTCGGTAAATGGAGAGATTCAGGGCAATGTGCCATCGACTGATATTGGGGGGTGAGTGGGGGGTGGGTTCAGGTTTTCTCTCAAGTGTCTCATCTTTGCCAGAAAAGACTGAGAGCCATCCAAGCTAATCTTCTCATGTCACTGCCAAATTCAGGCCAATTGAAGCAGCACTTACAGAAAATGTGACCAATTTGAGAAAGCCTGGGA
OTHER y607 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous arid1by607/+ (AB) arid1b Unknown

CITATIONS  (2)