header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190218-2
Genomic Feature: ibl52
Synonyms:
Affected Genomic Regions: sqstm1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-sqstm1
Lab Of Origin: Meijer Lab
Location: Chr 14: 16769042 - 16769079 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 37 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GACGTCAGCATCTTTAATAACTATGCAAACAGTGATTGGTTGATGGGGAGTCTATCAGAGATTGATTCAATAAAACTTTGTAGAGAACAATATTTCGTTGCCCTATTCAAATAGGGGGGGGGGGGGTAAATATTTTTGAAAACCTTTTTCTTTCCATAAGGGAATACTAGTGAGGATCTTTTGTGAAGATTTTGATTGGTTCTTGGATTCACTCTTGTTATTTGAGTACTAGAATACTATAAAACTAAAACACCTGCCACTTACATGTGCACAGTTTATAAGGTTGGAAAGATTACATGATTGGAAAGAGCGTCTAATGATGACATTAGATTTAAAGAGTGTGAATACTTTTTCATCTTGGATTCATCATTACGTACTTTGACCATACAAGCCTTTGAATATCTCAGATCTTTTGCAAATAGACATCTTCAATTAATAGCAATTATGTTATTTCCTTCTTTTTCAGAACGAAAAGAGCACAAACGTGATTCTTCTCCTCA
TGGAATTCCTGGGTTTCCGTTCACTACACCTCACTTTA/-
GCCCTCCTGGTCCCTGTCATATGGGTCCATCTCCAATGGGGCCTCCAGGACCACCTCATATGGGGGGTCCTCCTCACCACCCTCACCCAATGGTGCACCCAGGTGTGACCTGTGACGGGTGTGATGGGCCGGTGGCTGGAACCCGTTACAAGTGCACCGTTTGCCCCGATTATGACTTGTGCCCCACCTGCCAGAGCAAAGGCCTGCACAAGGAGCATGCCCTCCTGCCCATCTTTCATCCTATGGCCAACGTGTTTGAGGTGAATAGCACTATTTTACTACATACAATACACTGCAAATGATCTGAATATTTTGGTTTGATTAATCTTTTGTGTGCAGTGGCTCCCTCGTGGGAAATTTTGGCGTAAGATGAGACACTGCATGTGGGCAAATGCTCAAGCTCAGGCTCAAAACCAGCCTCAGCCAGGTCCATCTGGAGCGCAGCAAAACCAGGATGCTCCTGAAAACCCAAATGAGAATGGTAAGCCAATCATTTAAAA
NOTES
Comment Citation
short guide RNA was designed to target the beginning of coding exon 2 of  ... Zebrafish Nomenclature Committee
OTHER ibl52 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)