header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190130-3
Genomic Feature: ic3031
Synonyms:
Affected Genomic Regions: dab1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-dab1a
Lab Of Origin: Del Bene Lab
Location: Chr 20: 8245759 - 8245780 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 22 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CTATTTAAACAATGTGGCACAAAACGTGAAAATAACAGTTGCGCTGGCCGGAACATAGCAACAGATGGTGCCATACACGTCTTGTTCCTTATTGCACCTGACTGGGTCCCATGTCATATAGCCTATAACAAGTCATGTTTCTATTTTACATTTTGGAAGAAGAAATATGTACATATATGGTTTCAACAACCAAATGCAAATAGATCTGTCCAGTTACATTTGAAATGTGTCTTAGACCACCTCTTGAAGTGCTTTGATTAATTAGATTTAAATACATCTCAAATTTGATTTAGAAGGCATTTACAACTGCCATTTTCACAGTCGGACAGACATCCAATCAAAGAAAAGAAAAAAAAACCTGTGAAGTGACAAAATAAACAGCCACACACTATTTTAAAAAGAAGTCAGTGAAATCAATACACACCTTGAGTTTCATCATTGAGTCCTGACAGAGTTTGTCTCCTCTAGCTGCAGTGACCTCATCTATCCCGATGAGCTTA
GCCTTGTAACGAACGCCATCTC/-
CCTTAAAACGCTTTATCAGAGCTGCTTCACTGCGGTCCTGCCCTGGAGAAAGAAAAAAAAAGAGAGGGAGACAGATGAAGCATTAAGTCATTTGATGAATTTTGCATATCTGCATCACATCTCCTCCTCCCTCCATCTACTATCATCTCAAAACGCCATTACTGTTCCCACAGATCAGCACAATCCAGCCCTTGCAGCAGACAAAAACCGAGCGATATTCTAATAACTTGTATTTAGCCCAGCCCAGATCCTCATATTTCTAACACAGTGTTCTGTTTGAGCGGTCAGATCTTTAATCTCAGTCTAGTTGTGGAGTTCCAGCTGGAATTTGTCAGCGTGAGCCTGAGGGGCTGTTAAAAAGCCAGGAGGTTTAAAATCAACCCAGAGCTCTGAAAGCCCTCTCTAACCGTACGTCGGGCGCCATATTTACAGCTCAGAATGAAGGTCAAGCCTACTGCATGTGTGCAGCCATAATTGAAGGTATGTCACGCCCTGGGCAC
OTHER ic3031 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex s356tTg ; dab1aic3031/ic3031 dab1a

CITATIONS  (1)