ZFIN ID: ZDB-ALT-190123-641
Genomic Feature: sa45021
Synonyms:
Affected Genomic Regions: b4galnt4a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 24593800 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
GGATTGAACAAAATAAATAAAGTTGTCCCAATGAAATCTTAATAATTGTGTTGTTTTATTTCCTTTTAAATAAGTAGTTTGAACAAGCAACAAAAAAACTGAGTGAAAGACACAGTAGTTTGAGTTTTTTTTTGTGTATTTACTTTGAATGTTCTATATTAGATTTTCTCGAAGAAGAAGAGGGAGTGGATCCGGATGATGAAGCACAAGTTGTTGGCACCCAGTCAGCAAAGAAAACCATCCAACCTAGCCAGTCAACTCACACCTTAAGCCCTTCAGACAAACCTGTTCCCACAATGCTGGACAGAAAAGAAGTAGAACCAGGGAACCCAGCATTAAGAAGAGAGCAAAGGCGCTTTTTTGCCAGTGCAAGGCAGCCAGTAGTGCCTGAAGCTCAAGAGATGGAAAAAGACACTCCGGACCATCAAATTAATGTAGGGTCACCAAAAAGTGAGAGTGTGGTGAGAGGTCGTTCTCTTGCTTGGGTTCAAAGAGACCGT
(1)
OTHER sa45021 PAGES
ZMP:sa45021 (1)
GENOTYPES No data available

CITATIONS  (1)