ZFIN ID: ZDB-ALT-190123-528
Genomic Feature: sa44903
Synonyms:
Affected Genomic Regions: krt1-19d (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 5325038 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
TACTCTGCGATCTCCATCTCCAGTCTGGCCTTGATGTCCAGAAGCATCTG
A/C
TAATCATGACGTTGGCGCTCCAGATCAGCTCGGAGCTGCACTATCTGCTC
(1)
OTHER sa44903 PAGES
ZMP:sa44903 (1)
GENOTYPESNo data available

CITATIONS  (1)