header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-396
Genomic Feature: sa44758
Synonyms:
Affected Genomic Regions: chadlb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 19002216 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
TCACACACAACCAACTGGTGTACATCCCTAACATGGCGTTCCAGGGTTTG
C/T
AGAACATTAAATGGCTACGTCTCAGCCACAATTTCATCAATTATCTGGCA
(1)
OTHER sa44758 PAGES
ZMP:sa44758 (1)
GENOTYPES No data available

CITATIONS  (1)