header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-268
Genomic Feature: sa44618
Synonyms:
Affected Genomic Regions: ccnb1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 54713066 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
TCCTCTCCTGTTCCTATGGAGACCTCCGGCTGTGCTTCAGATGATCTGTG
T/A
CAAGCATTCTCTGATGTTCTGCTTAATATCAAGGATGTTGACGCAGATGA
(1)
OTHER sa44618 PAGES
ZMP:sa44618 (1)
GENOTYPESNo data available

CITATIONS  (1)