ZFIN ID: ZDB-ALT-190123-144
Genomic Feature: sa38905
Synonyms:
Affected Genomic Regions: jakmip3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 41641266 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
FLANKING SEQUENCE (GENOMIC)
AAATTACTTATCTATAAAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATGACAATGATAATGAAACAAATATAAACAAACATAAACAATGAAAAATATTTTTTAATAAAAAATAAAACAAAATATTATCTATAAATATAATATCTAATGACAAAGCTCAAAGAGAAAAATGTAATATAAAAAACAACTTTTTTTATTAATTAAAGGACTTTGCATTTTTTATAAGTCACAATTCACTTCTGAATTATAATGTATTACTGTATTATATTATTAATTTATTTATTCTGGATAATATCAGTAAGATGAAATGAAAGGATGTAAAGTATTTACCTTTTCACTTTCAATGTCCATCATCTTCTGCTGTAATGCTGATTTGGTGACTTCAATATTTTCTAACCACTGAAAACAACAAAGACAAATTAATAAAACAGCAAGCGAACAATATAAAATAACTTACAATGAAACGTCTCATA
C/T
CTTCTCTGCTAATGTTAGTACGGTCCTGGCATGAATAACCACCACTTGCTCCTCATTAGTCAGATTCTGTGTGTGTGTCATCCAATCAGAAGACAGACATCAGTGACAGAAACACGTGTGTATCGAACACAAAACCAGGCATGAGGAAACACACATTTACAGATGAAATCAACATACACTTACGGCGTTATCCCCCAGAATATCAAGCTTCTTCATCAGCTCCGTGATCACAATATCCTGCAGTGTGAAAAAGACTTTAATATTAAGAGAAATTAACCAAAAACTCCTTCTATCAGATAAAAAAGCACAGTCTATTTCATTTGATATCAACAACTGAAAACTGCACAAAACATTGAAGCTCTCAGATCATGTATAATAAATTAACAATAATAATAATAATTCTAGGTAAATAGGTGTTGTTTTACATGTGAATGGTTTTCATCAATACCTGTATTTTCAGAATTTTTTAAACATCCTATTTAATGTCCCATTATATCCAA
(1)
OTHER sa38905 PAGES
ZMP:sa38905 (1)
GENOTYPES No data available

CITATIONS  (1)