Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb326

ID
ZDB-ALT-181218-19
Name
ihb326
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb326 GGCCAACCTTAATATCCCGATGGGGGCTCTTAATATCCCTTAATATCCCGAGCGGGACATCCTGTGAAGAGG
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr: 24 Details
Nucleotide change
Variant Notes
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb326  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
19 bp inserted / 8 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
None
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations