header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181218-19
Genomic Feature: ihb326
Synonyms:
Affected Genomic Regions: smpx (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR4-smpx
Lab Of Origin: Yonghua Sun Lab
Location: Chr: 24 Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 19 bp inserted / 8 bp deleted (1)
FLANKING SEQUENCENo data available
NOTES
Comment Citation
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb326  ... Zebrafish Nomenclature Committee
OTHER ihb326 PAGESNo links to external sites
GENOTYPESNo data available

CITATIONS  (1)