ZFIN ID: ZDB-ALT-181218-18
Genomic Feature: ihb325
Synonyms:
Affected Genomic Regions: smpx (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR4-smpx
Lab Of Origin: Yonghua Sun Lab
Location: Chr: 24 Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 4 bp deleted (1)
FLANKING SEQUENCE (GENOMIC) No data available
NOTES
Comment Citation
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb325  ... Zebrafish Nomenclature Committee
OTHER ihb325 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)