ZFIN ID: ZDB-ALT-181218-15
Genomic Feature: ihb322
Synonyms:
Affected Genomic Regions: ctsl.1 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-ctsl.1
Lab Of Origin: Yonghua Sun Lab
Location: Chr 17: 27457274 - 27457277 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp inserted / 4 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CCCTTCAATGTGTTCCCCGGCATTACACCCATATACACCACACGCAATATTGCTCTTACGCAATTTCCCTTTTTCATCTTTGCACTCAGCAATGCTCTTCTGTTTATGATTTTATGAGAGGCACCTGACCACCGACACCAAAGACTCCTATATAAACCCGGATGTTCATTCAGACAAATGCTGACACACAGGTGACAAGGAAATCTATAGATCTTGCACCACAACAAGTAAGTATTCAAACTCAGGTTGAACCAGATTTCAGGCCTCCTATGGAACTAAAAATACTGTTACTGTACTGAGGACAAATGTGTGGGTGGGTGACAGAAAACCTGAAATGATGACATCAGACACTTGAGTCTGTTTTATCTTACGCACCTCTATGCGACCTCACATTTGTCTGATTTCTTTTCTCTGTGCAGGATGAGGGTTCTGGTCGTTGCTGCTGCTTTTCTGGCTGTTGCCAGTGCTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCA
CGCC/TTGAAGTT
TGGAAACTGAAGTTTGGTAAGTCTAGCTTTTTTTCTTAGCTGTAGCATATTGCAGGTTCTCCTTAGTGACTGCAATAACTAATTCAAAATAGGCAAGGCAAGTTTGGGCTTTTTATATAACACATTTCATAGACAATGGCAGGTCTAATTCAAAGTACTTAAAATAAAAAAAAAATAATTTAAAGGAATAATAAAATAAGTAATTGAGAAATGGTTAAAAGGTTTAAAAAGAGAGATGTATGAATAGCGTGATCAGATCAGCATCTGATCATTTCTGGAAGCTGCGGTTGGCATAGTAGCTGAAAGCAGGTTCAGCATGCTTTGACTGAGCTCTTGGAATTTTTTTATTCACTCAATCATACTGATAAGATTGATCCGTTATGTTTATACTCTGTGGGCATAACTGCAATGCTTTAAGGTCCTAGGCCATTTACTGATTTATAAACAATTAAAAATAATTTAAAATCTACTTTAATTAGAAGCCAGTGTAAAGACCTGAG
NOTES
Comment Citation
>WT CTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCACGCCTGGAAACTGAAGTTTGGTAAGTCTAGC > ihb322  ... Zebrafish Nomenclature Committee
OTHER ihb322 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)