Genomic Feature

ihb322

ID
ZDB-ALT-181218-15
Name
ihb322
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
>WT CTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCACGCCTGGAAACTGAAGTTTGGTAAGTCTAGC > ihb322 CTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCATTGAAGTTTGGAAACTGAAGTTTGGTAAGTCTAGC
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 17: 27457274 - 27457277 (GRCz11) (1) Details
Nucleotide change
CGCC/TTGAAGTT
Variant Notes
>WT CTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCACGCCTGGAAACTGAAGTTTGGTAAGTCTAGC > ihb322  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp inserted / 4 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CCCTTCAATGTGTTCCCCGGCATTACACCCATATACACCACACGCAATATTGCTCTTACGCAATTTCCCTTTTTCATCTTTGCACTCAGCAATGCTCTTCTGTTTATGATTTTATGAGAGGCACCTGACCACCGACACCAAAGACTCCTATATAAACCCGGATGTTCATTCAGACAAATGCTGACACACAGGTGACAAGGAAATCTATAGATCTTGCACCACAACAAGTAAGTATTCAAACTCAGGTTGAACCAGATTTCAGGCCTCCTATGGAACTAAAAATACTGTTACTGTACTGAGGACAAATGTGTGGGTGGGTGACAGAAAACCTGAAATGATGACATCAGACACTTGAGTCTGTTTTATCTTACGCACCTCTATGCGACCTCACATTTGTCTGATTTCTTTTCTCTGTGCAGGATGAGGGTTCTGGTCGTTGCTGCTGCTTTTCTGGCTGTTGCCAGTGCTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCA
CGCC/TTGAAGTT TGGAAACTGAAGTTTGGTAAGTCTAGCTTTTTTTCTTAGCTGTAGCATATTGCAGGTTCTCCTTAGTGACTGCAATAACTAATTCAAAATAGGCAAGGCAAGTTTGGGCTTTTTATATAACACATTTCATAGACAATGGCAGGTCTAATTCAAAGTACTTAAAATAAAAAAAAAATAATTTAAAGGAATAATAAAATAAGTAATTGAGAAATGGTTAAAAGGTTTAAAAAGAGAGATGTATGAATAGCGTGATCAGATCAGCATCTGATCATTTCTGGAAGCTGCGGTTGGCATAGTAGCTGAAAGCAGGTTCAGCATGCTTTGACTGAGCTCTTGGAATTTTTTTATTCACTCAATCATACTGATAAGATTGATCCGTTATGTTTATACTCTGTGGGCATAACTGCAATGCTTTAAGGTCCTAGGCCATTTACTGATTTATAAACAATTAAAAATAATTTAAAATCTACTTTAATTAGAAGCCAGTGTAAAGACCTGAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations