header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181218-14
Genomic Feature: ihb321
Synonyms:
Affected Genomic Regions: ctsl.1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-ctsl.1
Lab Of Origin: Yonghua Sun Lab
Location: Chr 17: 27457260 - 27457275 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 16 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTTACAGGAAACTTCCCTTCAATGTGTTCCCCGGCATTACACCCATATACACCACACGCAATATTGCTCTTACGCAATTTCCCTTTTTCATCTTTGCACTCAGCAATGCTCTTCTGTTTATGATTTTATGAGAGGCACCTGACCACCGACACCAAAGACTCCTATATAAACCCGGATGTTCATTCAGACAAATGCTGACACACAGGTGACAAGGAAATCTATAGATCTTGCACCACAACAAGTAAGTATTCAAACTCAGGTTGAACCAGATTTCAGGCCTCCTATGGAACTAAAAATACTGTTACTGTACTGAGGACAAATGTGTGGGTGGGTGACAGAAAACCTGAAATGATGACATCAGACACTTGAGTCTGTTTTATCTTACGCACCTCTATGCGACCTCACATTTGTCTGATTTCTTTTCTCTGTGCAGGATGAGGGTTCTGGTCGTTGCTGCTGCTTTTCTGGCTGTTGCCAGTGCTGCCAGTCTTTCTCTGGAG
GACATGGAGTTTCACG/-
CCTGGAAACTGAAGTTTGGTAAGTCTAGCTTTTTTTCTTAGCTGTAGCATATTGCAGGTTCTCCTTAGTGACTGCAATAACTAATTCAAAATAGGCAAGGCAAGTTTGGGCTTTTTATATAACACATTTCATAGACAATGGCAGGTCTAATTCAAAGTACTTAAAATAAAAAAAAAATAATTTAAAGGAATAATAAAATAAGTAATTGAGAAATGGTTAAAAGGTTTAAAAAGAGAGATGTATGAATAGCGTGATCAGATCAGCATCTGATCATTTCTGGAAGCTGCGGTTGGCATAGTAGCTGAAAGCAGGTTCAGCATGCTTTGACTGAGCTCTTGGAATTTTTTTATTCACTCAATCATACTGATAAGATTGATCCGTTATGTTTATACTCTGTGGGCATAACTGCAATGCTTTAAGGTCCTAGGCCATTTACTGATTTATAAACAATTAAAAATAATTTAAAATCTACTTTAATTAGAAGCCAGTGTAAAGACCTG
NOTES
Comment Citation
>WT CTGCCAGTCTTTCTCTGGAGGACATGGAGTTTCACGCCTGGAAACTGAAGTTTGGTAAGTCTAGC > ihb321  ... Zebrafish Nomenclature Committee
OTHER ihb321 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)