header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181218-13
Genomic Feature: ihb320
Synonyms:
Affected Genomic Regions: tnfrsf1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-tnfrsf1a
Lab Of Origin: Yonghua Sun Lab
Location: Chr 16: 17063376 - 17063380 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GATAGATTTGTGAGGGGTGTACTTATATATGCTGAGCACTGTATACTGTGAAATGTGACCAGGACATGTTTTATTAAATGTGCGATTTGCAGAAATCACCCAAACCCCATTGACCCAACCACCCATTCAAAAAATAGCTCTAAAAATCTTTGACAAAATATATACATGTAATATAAAAAAGTACATACGTCATTGAACACAGAATGTTCACAAGTTCATAAAACATTTTAGTGTGAAATTTTCAGTCTGGCAATACGTCTGATTTGGTGTCTAGCTCTTGAGACTTCCACTTTCAATGAAATCCAATGCGAACGAGTGGAAGTTAAAGATCTCTGTTAATGCCCTGTTCTCCATTCTCCTCCGATGTCCTCATTACGAAACGCTTGTGTTCTGTGAAAGGAACTTGTTCTCAATGTTATCTGCGCAGCTAACCAGACACATGTCTTTCAGTGTGCTCATGAGCATCTGGATTTGGTCATACGGCACAACATTGTTCCCTC
CTCCA/-
CTGCCACCATCACTCCAAACTTTCAGCATCTGATACTGGGCGTCCTTGCAGTTCCGGTGGTCATGTTCTGCCCGGTCAATGTTCTGCTCAGAAACTCCAAGCCGACGTACAAGCTCTTTAAATCGTCCGATAGGGACCTCGTCCAGCACAAAATAGAAGAACTCGTGAACTGCAAATAGCAGAAGAGACACGAATCATTAAGCACCATTACTCAAGCCTCCAGGGGTTTGTGTTGAAACAAATAAAAAAGACATACTTTTGATCTCTCTTGGGATGCAGTCTGGGAGATTCCCTAGAGGTTTGGATTCACATGGCTGATTTGTGAATGATACGCTCTTATTTTTTGAGTCCTGCACTACAGTGATGATGAATGCCTGTGAGGAACAGCAAAACCATAAATGAACACTGGTCAGTTAGAGCATAGGATGTATCTCAATGTATGATATTGAGATAGATGGCATACTTGAAGGTACTGGGAAAATCTTATGGATTAATAATTA
NOTES
Comment Citation
>WT AGATGCTGAAAGTTTGGAGTGATGGTGGCAGTGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA >  ... Zebrafish Nomenclature Committee
OTHER ihb320 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)