Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb320

ID
ZDB-ALT-181218-13
Name
ihb320
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
>WT AGATGCTGAAAGTTTGGAGTGATGGTGGCAGTGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA > ihb320 AGATGCTGAAAGTTTGGAGTGATGGTGGCAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 16: 17063376 - 17063380 (GRCz11) (1) Details
Nucleotide change
CTCCA/-
Variant Notes
>WT AGATGCTGAAAGTTTGGAGTGATGGTGGCAGTGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA >  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GATAGATTTGTGAGGGGTGTACTTATATATGCTGAGCACTGTATACTGTGAAATGTGACCAGGACATGTTTTATTAAATGTGCGATTTGCAGAAATCACCCAAACCCCATTGACCCAACCACCCATTCAAAAAATAGCTCTAAAAATCTTTGACAAAATATATACATGTAATATAAAAAAGTACATACGTCATTGAACACAGAATGTTCACAAGTTCATAAAACATTTTAGTGTGAAATTTTCAGTCTGGCAATACGTCTGATTTGGTGTCTAGCTCTTGAGACTTCCACTTTCAATGAAATCCAATGCGAACGAGTGGAAGTTAAAGATCTCTGTTAATGCCCTGTTCTCCATTCTCCTCCGATGTCCTCATTACGAAACGCTTGTGTTCTGTGAAAGGAACTTGTTCTCAATGTTATCTGCGCAGCTAACCAGACACATGTCTTTCAGTGTGCTCATGAGCATCTGGATTTGGTCATACGGCACAACATTGTTCCCTC
CTCCA/- CTGCCACCATCACTCCAAACTTTCAGCATCTGATACTGGGCGTCCTTGCAGTTCCGGTGGTCATGTTCTGCCCGGTCAATGTTCTGCTCAGAAACTCCAAGCCGACGTACAAGCTCTTTAAATCGTCCGATAGGGACCTCGTCCAGCACAAAATAGAAGAACTCGTGAACTGCAAATAGCAGAAGAGACACGAATCATTAAGCACCATTACTCAAGCCTCCAGGGGTTTGTGTTGAAACAAATAAAAAAGACATACTTTTGATCTCTCTTGGGATGCAGTCTGGGAGATTCCCTAGAGGTTTGGATTCACATGGCTGATTTGTGAATGATACGCTCTTATTTTTTGAGTCCTGCACTACAGTGATGATGAATGCCTGTGAGGAACAGCAAAACCATAAATGAACACTGGTCAGTTAGAGCATAGGATGTATCTCAATGTATGATATTGAGATAGATGGCATACTTGAAGGTACTGGGAAAATCTTATGGATTAATAATTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations