Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb319

ID
ZDB-ALT-181218-12
Name
ihb319
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
>WT AGATGCTGAAAGTTTGGAGTGATGGTGGCAGTGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA > ihb319 AGATGCTGAAAGTTTGGAGTGATGGTGGCAGGGAACAATGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 16: 17063380 - 17063381 (GRCz11) (1) Details
Nucleotide change
-/TTGTTCC
Variant Notes
>WT AGATGCTGAAAGTTTGGAGTGATGGTGGCAGTGGAGGAGGGAACAATGTTGTGCCGTATGACCAAATCCAGA >  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp inserted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GATTTGTGAGGGGTGTACTTATATATGCTGAGCACTGTATACTGTGAAATGTGACCAGGACATGTTTTATTAAATGTGCGATTTGCAGAAATCACCCAAACCCCATTGACCCAACCACCCATTCAAAAAATAGCTCTAAAAATCTTTGACAAAATATATACATGTAATATAAAAAAGTACATACGTCATTGAACACAGAATGTTCACAAGTTCATAAAACATTTTAGTGTGAAATTTTCAGTCTGGCAATACGTCTGATTTGGTGTCTAGCTCTTGAGACTTCCACTTTCAATGAAATCCAATGCGAACGAGTGGAAGTTAAAGATCTCTGTTAATGCCCTGTTCTCCATTCTCCTCCGATGTCCTCATTACGAAACGCTTGTGTTCTGTGAAAGGAACTTGTTCTCAATGTTATCTGCGCAGCTAACCAGACACATGTCTTTCAGTGTGCTCATGAGCATCTGGATTTGGTCATACGGCACAACATTGTTCCCTCCTCCA
-/TTGTTCC CTGCCACCATCACTCCAAACTTTCAGCATCTGATACTGGGCGTCCTTGCAGTTCCGGTGGTCATGTTCTGCCCGGTCAATGTTCTGCTCAGAAACTCCAAGCCGACGTACAAGCTCTTTAAATCGTCCGATAGGGACCTCGTCCAGCACAAAATAGAAGAACTCGTGAACTGCAAATAGCAGAAGAGACACGAATCATTAAGCACCATTACTCAAGCCTCCAGGGGTTTGTGTTGAAACAAATAAAAAAGACATACTTTTGATCTCTCTTGGGATGCAGTCTGGGAGATTCCCTAGAGGTTTGGATTCACATGGCTGATTTGTGAATGATACGCTCTTATTTTTTGAGTCCTGCACTACAGTGATGATGAATGCCTGTGAGGAACAGCAAAACCATAAATGAACACTGGTCAGTTAGAGCATAGGATGTATCTCAATGTATGATATTGAGATAGATGGCATACTTGAAGGTACTGGGAAAATCTTATGGATTAATAATTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations